ID: 923280600_923280605

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 923280600 923280605
Species Human (GRCh38) Human (GRCh38)
Location 1:232439394-232439416 1:232439419-232439441
Sequence CCATCAGGTCGCCAGACCCAAAG CTTGTCGTCACTGTTGCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 88} {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!