ID: 923281522_923281524

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 923281522 923281524
Species Human (GRCh38) Human (GRCh38)
Location 1:232447524-232447546 1:232447546-232447568
Sequence CCGACAGAGAATGGCTGAACTTC CAGTGGTCCCTCACCACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 151} {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!