ID: 923334194_923334197

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 923334194 923334197
Species Human (GRCh38) Human (GRCh38)
Location 1:232952689-232952711 1:232952710-232952732
Sequence CCTTTTACACATAACTTTTTTCC CCCCATTAGGAGTTATTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 450} {0: 1, 1: 0, 2: 0, 3: 5, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!