ID: 923334742_923334745

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 923334742 923334745
Species Human (GRCh38) Human (GRCh38)
Location 1:232958412-232958434 1:232958438-232958460
Sequence CCTCTCTGCTCCTTGACATTCAG TCAGCTGAAGTATGTAGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 295} {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!