ID: 923369337_923369341

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 923369337 923369341
Species Human (GRCh38) Human (GRCh38)
Location 1:233295267-233295289 1:233295282-233295304
Sequence CCTTTCTCCTTCTTCCCTCCATA CCTCCATACCCACAGCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 128, 4: 1189} {0: 1, 1: 0, 2: 2, 3: 34, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!