ID: 923369346_923369363

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 923369346 923369363
Species Human (GRCh38) Human (GRCh38)
Location 1:233295291-233295313 1:233295331-233295353
Sequence CCACAGCTCCCCGGGACCGGACC GCAGGGCCAGGGGCAGCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175} {0: 1, 1: 7, 2: 41, 3: 340, 4: 1631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!