ID: 923404495_923404499

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 923404495 923404499
Species Human (GRCh38) Human (GRCh38)
Location 1:233646593-233646615 1:233646620-233646642
Sequence CCGAGTGCAGGGAGTGAGAGCAG AAGGTCTGAAGGCCGAGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 331} {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!