ID: 923412724_923412732

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 923412724 923412732
Species Human (GRCh38) Human (GRCh38)
Location 1:233725836-233725858 1:233725872-233725894
Sequence CCAGTTTGCACAGGGAAAGAGAA TTGGGAGCATGTCAGGTTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 99, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!