ID: 923439903_923439911

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 923439903 923439911
Species Human (GRCh38) Human (GRCh38)
Location 1:234007402-234007424 1:234007431-234007453
Sequence CCAAGTTCCTCCTGCGGAGAAGG TGTGGGTGCAGAAGCCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 159} {0: 1, 1: 0, 2: 3, 3: 38, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!