ID: 923445463_923445477

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 923445463 923445477
Species Human (GRCh38) Human (GRCh38)
Location 1:234066608-234066630 1:234066658-234066680
Sequence CCACTACCTTCTCCTTCCCAAAG CTCAAATAGAAGTTGGACGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 799} {0: 1, 1: 0, 2: 1, 3: 8, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!