ID: 923447860_923447865

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 923447860 923447865
Species Human (GRCh38) Human (GRCh38)
Location 1:234089272-234089294 1:234089307-234089329
Sequence CCTGAAAGTCAGTCAGCCTGGGC GAGGTAGAACTCACTGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 157} {0: 1, 1: 0, 2: 2, 3: 14, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!