ID: 923469937_923469939

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 923469937 923469939
Species Human (GRCh38) Human (GRCh38)
Location 1:234281450-234281472 1:234281467-234281489
Sequence CCTTGTTTGCTCTTTGTACCCAT ACCCATTTGGCAGAGCAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239} {0: 1, 1: 0, 2: 0, 3: 15, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!