|
Left Crispr |
Right Crispr |
| Crispr ID |
923485661 |
923485664 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:234428525-234428547
|
1:234428548-234428570
|
| Sequence |
CCAGTTTTTCATACAGATTTCCC |
AACTTTTTTTTTTTTTGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 24, 4: 225} |
{0: 361, 1: 3395, 2: 15991, 3: 120488, 4: 89974} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|