ID: 923532364_923532369

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 923532364 923532369
Species Human (GRCh38) Human (GRCh38)
Location 1:234821610-234821632 1:234821635-234821657
Sequence CCCTGAGCCATCTGGACTAAAGC ATGGCACAGAAGAATGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!