ID: 923539346_923539356

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 923539346 923539356
Species Human (GRCh38) Human (GRCh38)
Location 1:234877036-234877058 1:234877072-234877094
Sequence CCTCTCTCAACCTCCCAAGTAGC GCCACCATGCCCCGTATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 355, 2: 9912, 3: 110381, 4: 210626} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!