ID: 923539353_923539355

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 923539353 923539355
Species Human (GRCh38) Human (GRCh38)
Location 1:234877050-234877072 1:234877071-234877093
Sequence CCAAGTAGCTGGGGTTACAGGCG CGCCACCATGCCCCGTATGGTGG
Strand - +
Off-target summary {0: 280, 1: 22037, 2: 147850, 3: 176513, 4: 255261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!