ID: 923546747_923546754

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 923546747 923546754
Species Human (GRCh38) Human (GRCh38)
Location 1:234928896-234928918 1:234928932-234928954
Sequence CCTAATAAGAGCAGGGCAGCGTC TTTACAGAGACTGCTGAAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!