ID: 923580026_923580028

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 923580026 923580028
Species Human (GRCh38) Human (GRCh38)
Location 1:235200755-235200777 1:235200788-235200810
Sequence CCAAATTTACCTTAGACATAATA TAGTCAATGCAGATAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 223} {0: 1, 1: 0, 2: 1, 3: 31, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!