ID: 923608149_923608151

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 923608149 923608151
Species Human (GRCh38) Human (GRCh38)
Location 1:235464093-235464115 1:235464111-235464133
Sequence CCAAGACCTACGTATAAGTGCTA TGCTAAAACTATAAAACTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 46} {0: 1, 1: 16, 2: 64, 3: 120, 4: 546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!