ID: 923611791_923611795

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 923611791 923611795
Species Human (GRCh38) Human (GRCh38)
Location 1:235502563-235502585 1:235502582-235502604
Sequence CCTTAATCTAGCCTGGTCTAACT AACTACTGGATGGCAGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78} {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!