ID: 923623789_923623802

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 923623789 923623802
Species Human (GRCh38) Human (GRCh38)
Location 1:235598007-235598029 1:235598039-235598061
Sequence CCCTGACTCTGGCTACCCAAGAC AGGGCTGAGGTGCTGGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 140} {0: 1, 1: 0, 2: 1, 3: 24, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!