ID: 923624217_923624223

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 923624217 923624223
Species Human (GRCh38) Human (GRCh38)
Location 1:235601024-235601046 1:235601062-235601084
Sequence CCCCATGGCTGCTGCTGTTTCAG AAATTAACTCTGGGTTGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 360} {0: 1, 1: 0, 2: 0, 3: 17, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!