ID: 923627842_923627856

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 923627842 923627856
Species Human (GRCh38) Human (GRCh38)
Location 1:235628554-235628576 1:235628600-235628622
Sequence CCCACCCAGATGATGGTGTCCTA CTGGTCCTGTGTAAGTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89} {0: 1, 1: 0, 2: 1, 3: 13, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!