ID: 923630925_923630945

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 923630925 923630945
Species Human (GRCh38) Human (GRCh38)
Location 1:235649381-235649403 1:235649428-235649450
Sequence CCCCCAGCCCCGGAAGCCCCTGG ACCCGCGCGCGGGCTTCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 647} {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!