ID: 923631272_923631278

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 923631272 923631278
Species Human (GRCh38) Human (GRCh38)
Location 1:235650336-235650358 1:235650351-235650373
Sequence CCGGAGGGGTCTGGGGCGGGGCC GCGGGGCCGGGGTTGCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 53, 4: 405} {0: 1, 1: 1, 2: 0, 3: 24, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!