ID: 923685881_923685883

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 923685881 923685883
Species Human (GRCh38) Human (GRCh38)
Location 1:236153310-236153332 1:236153342-236153364
Sequence CCATCTGCTTTCTATCTCTGCAG TCCTTAATATTTCATATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 74, 4: 474} {0: 1, 1: 0, 2: 9, 3: 129, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!