ID: 923688805_923688806

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 923688805 923688806
Species Human (GRCh38) Human (GRCh38)
Location 1:236173573-236173595 1:236173586-236173608
Sequence CCTGCATTTGCTGACCAGCAGCA ACCAGCAGCACTGATCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 192} {0: 1, 1: 0, 2: 0, 3: 15, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!