ID: 923721279_923721287

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 923721279 923721287
Species Human (GRCh38) Human (GRCh38)
Location 1:236469082-236469104 1:236469134-236469156
Sequence CCCGCTCCCCTTTTTTAATCATA CTCATTAATCAGAAGGGATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 219} {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!