|
Left Crispr |
Right Crispr |
| Crispr ID |
923734016 |
923734026 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:236583731-236583753
|
1:236583772-236583794
|
| Sequence |
CCCGCCTCGGCCTCCCAAAATGC |
CTACCGTGCCTGGCCAAAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3197, 1: 96511, 2: 232732, 3: 241203, 4: 238990} |
{0: 1, 1: 2, 2: 39, 3: 233, 4: 967} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|