|
Left Crispr |
Right Crispr |
| Crispr ID |
923734021 |
923734026 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:236583741-236583763
|
1:236583772-236583794
|
| Sequence |
CCTCCCAAAATGCTGGGATTATA |
CTACCGTGCCTGGCCAAAATAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1562, 1: 42775, 2: 341097, 3: 259675, 4: 195051} |
{0: 1, 1: 2, 2: 39, 3: 233, 4: 967} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|