ID: 923746372_923746382

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 923746372 923746382
Species Human (GRCh38) Human (GRCh38)
Location 1:236704490-236704512 1:236704538-236704560
Sequence CCATCTCAAGTCCAGGCCTCCAG TGGGGTTCTCATGCCTCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 281} {0: 1, 1: 0, 2: 1, 3: 18, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!