ID: 923809352_923809356

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 923809352 923809356
Species Human (GRCh38) Human (GRCh38)
Location 1:237295259-237295281 1:237295293-237295315
Sequence CCGTACTTCAGTGTTTGGAAAAA CAGGAAAGTCAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 326} {0: 1, 1: 0, 2: 4, 3: 94, 4: 952}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!