ID: 923858607_923858615

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 923858607 923858615
Species Human (GRCh38) Human (GRCh38)
Location 1:237870820-237870842 1:237870866-237870888
Sequence CCACTTTACAGCATGTGGCTGGG GAGAATGAGTGAGTGCCAGATGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 52, 4: 548}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!