ID: 923904605_923904612

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 923904605 923904612
Species Human (GRCh38) Human (GRCh38)
Location 1:238369906-238369928 1:238369948-238369970
Sequence CCTTCCACTGGGTCCCTCTCATG GCTGCAATTAGAGATTTGAGTGG
Strand - +
Off-target summary {0: 5, 1: 81, 2: 740, 3: 1483, 4: 3100} {0: 1, 1: 1, 2: 6, 3: 65, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!