ID: 923904605_923904614

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 923904605 923904614
Species Human (GRCh38) Human (GRCh38)
Location 1:238369906-238369928 1:238369950-238369972
Sequence CCTTCCACTGGGTCCCTCTCATG TGCAATTAGAGATTTGAGTGGGG
Strand - +
Off-target summary {0: 5, 1: 81, 2: 740, 3: 1483, 4: 3100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!