ID: 923914966_923914971 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 923914966 | 923914971 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:238491871-238491893 | 1:238491893-238491915 |
| Sequence | CCATGCGCCAGTCTGTGGAGAGC | CCACATCCATGGGCTCTGCAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 5, 2: 20, 3: 42, 4: 241} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||