ID: 923937656_923937658

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 923937656 923937658
Species Human (GRCh38) Human (GRCh38)
Location 1:238781381-238781403 1:238781409-238781431
Sequence CCTACAGCATGATGGTGCTGAAC TTCTGATTTGGCATCTCCTTTGG
Strand - +
Off-target summary No data {0: 3, 1: 31, 2: 46, 3: 73, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!