ID: 923967271_923967273 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 923967271 | 923967273 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 1:239155891-239155913 | 1:239155916-239155938 |
| Sequence | CCTGACTGCCAGGAGAGAGTGCT | AGACACCAGTTGCAAGTCTCAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 2, 2: 11, 3: 48, 4: 258} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||