ID: 923994324_923994330

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 923994324 923994330
Species Human (GRCh38) Human (GRCh38)
Location 1:239475515-239475537 1:239475566-239475588
Sequence CCAAGAGGACCTAGGGATATATG TGGGATCTTAGAATAGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108} {0: 1, 1: 8, 2: 44, 3: 226, 4: 700}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!