ID: 924049034_924049035

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 924049034 924049035
Species Human (GRCh38) Human (GRCh38)
Location 1:240061759-240061781 1:240061787-240061809
Sequence CCTTAGAGACAAAAGTTTTCATG CAGAATAAACAAACAGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 253} {0: 1, 1: 0, 2: 7, 3: 112, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!