ID: 924062680_924062685

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 924062680 924062685
Species Human (GRCh38) Human (GRCh38)
Location 1:240192512-240192534 1:240192562-240192584
Sequence CCAACAAAACAATAACCCACAAG GTAAGAAATACAAGTCTTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 299} {0: 1, 1: 0, 2: 0, 3: 23, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!