ID: 924068118_924068122

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 924068118 924068122
Species Human (GRCh38) Human (GRCh38)
Location 1:240247097-240247119 1:240247139-240247161
Sequence CCTCTTCTGAATGTCTGCCTTCT TTGTTCCTATGTAAAATCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 407} {0: 1, 1: 0, 2: 1, 3: 18, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!