ID: 924068886_924068891

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 924068886 924068891
Species Human (GRCh38) Human (GRCh38)
Location 1:240255027-240255049 1:240255048-240255070
Sequence CCGCGGGGTTCTCCCATGGCTAC ACGATTGCAGGAGTCTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 98} {0: 1, 1: 1, 2: 24, 3: 44, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!