ID: 924099371_924099375

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924099371 924099375
Species Human (GRCh38) Human (GRCh38)
Location 1:240587968-240587990 1:240588005-240588027
Sequence CCTTGCTCTTTGATGGAAAACTG ATGGAACCCACGGTGCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 209} {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!