|
Left Crispr |
Right Crispr |
| Crispr ID |
924138520 |
924138523 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:240997707-240997729
|
1:240997738-240997760
|
| Sequence |
CCAGCTACTCAGGAGGCTGAGGC |
CACGTGAATCCAGGAGACAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038} |
{0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|