ID: 924138520_924138523

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 924138520 924138523
Species Human (GRCh38) Human (GRCh38)
Location 1:240997707-240997729 1:240997738-240997760
Sequence CCAGCTACTCAGGAGGCTGAGGC CACGTGAATCCAGGAGACAGAGG
Strand - +
Off-target summary {0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038} {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!