ID: 924149994_924149999

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 924149994 924149999
Species Human (GRCh38) Human (GRCh38)
Location 1:241120184-241120206 1:241120205-241120227
Sequence CCTCAGGCCTCTAAGGCATTGCC CCTGCCTACCTGGTTAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 186} {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!