ID: 924165568_924165578

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 924165568 924165578
Species Human (GRCh38) Human (GRCh38)
Location 1:241278631-241278653 1:241278667-241278689
Sequence CCCACTGAGTATCCCTTTTCCAC TCACCACTGCTCCCAACAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 165} {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!