ID: 924179051_924179060

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 924179051 924179060
Species Human (GRCh38) Human (GRCh38)
Location 1:241423433-241423455 1:241423476-241423498
Sequence CCCTTTTGACTACATACCCAGGT TCTCTATATATTTGCCTTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!