ID: 924183075_924183077

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 924183075 924183077
Species Human (GRCh38) Human (GRCh38)
Location 1:241458702-241458724 1:241458737-241458759
Sequence CCTGTGTGAGCTGGAGTTACGTG ACGAATAAGCAGAAACTATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 32, 4: 586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!