ID: 924213403_924213407

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924213403 924213407
Species Human (GRCh38) Human (GRCh38)
Location 1:241793840-241793862 1:241793892-241793914
Sequence CCTGCTTCATGTCTCATAACATG AATTATTCAGCTGGGTGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234} {0: 1, 1: 10, 2: 144, 3: 1581, 4: 17430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!